Results without control collection were identified as invalid. Patient and Sample Collection This study enrolled a total of 1 1,158 participants from five centers in China (The First Affiliated Hospital – Zhejiang University School of Medicine, Hubei Provincial Center for Disease Control and Prevention, The Third Hospital of Wuhan, Shanghai Public Health Clinical Center, Chongqing Public Health Medical Center), including 616 confirmed COVID-19 patients and 542 people Tuberculosis inhibitor 1 with a normal health examination (basic information of all participants shown in Table?1 ). detection of SARS-CoV-2 nucleocapsid-specific antibodies. Confirmed cases found in the Hubei Provincial Center for Disease Control and Prevention (HBCDC), showed a significantly (p = 0.0018) higher positive rate from your ALLtest than RNA test. Then, we further recognized the disease program, age, sex, and symptoms that were correlating factors with our ALLtest results. In summary, we confirmed the high reliability of our ALLtest and its important part in COVID-19 analysis. The correlating factors we identified will require special attention during future medical software. Keywords: COVID-19, SARS-CoV-2, nucleocapsid protein, antibody profile, serologic test, lateral circulation chromatographic immunoassay Intro Since December 2019, instances of pneumonia with unfamiliar etiology started to be reported in Wuhan city, Hubei province of China (World Health Business, 2020a). Shortly after this, a new type of coronavirus was isolated and named the novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). With a rapid boost of case figures caused by SARS-CoV-2, World Health Business (WHO) declared Coronavirus disease 2019 (COVID-19) like a pandemic in March 2020 (World Health Business, 2020b). Various steps have been taken, such as city lockdowns, travel restrictions, and mandatory face mask wearing. Regrettably, COVID-19 still quickly spread and recent estimations display that over 489 million instances and over 6 million deaths have been reported worldwide (World Health Business, 2022). RNA checks have long been considered as the gold standard, due to its direct viral detection. However, increasingly more shortcomings have been noticed which include, but not limited to, the following: 1) high false negative rate (Kucirka et?al., 2020) which lead to unreliable results and repetitive checks, and 2) test results that depend on location (e.g. oropharynx, nasopharynx) (Wikramaratna et?al., 2020). Under such conditions, antibody checks with their unique features can support RNA test results and mainly accelerate the detection rate (Yuce et?al., 2021). More importantly, an antibody test is able to show the infection process (Yuce et?al., 2021). Among all popular antibodies checks, the lateral circulation immunoassay (LFIA) test has exceptional advantages such as being quick and suitable for home-testing. Although it has been over two years since the 1st COVID-19 outbreak, there is still strong need to look back to the very beginning and find useful info for future epidemic prevention and control. Consequently, to exhibit reliable results, we summarized and reported antibody data of more than 1,000 participants from five centers during the 1st three months of 2020. Here, using our self-developed quick antibody test (ALLtest), we characterized serum antibody from multiple elements. Materials Tuberculosis inhibitor 1 Tuberculosis inhibitor 1 and Methods The Design of Our Quick Antibody Test (ALLtest) for COVID-19 Here we developed a SARS-CoV-2 IgG/IgM Quick Test Cassette which is a qualitative membrane-based immunoassay for the detection of IgG and IgM antibodies to SARS-CoV-2 nucleocapsid in whole blood, serum, or plasma specimen. The COVID-19 nucleocapsid gene was synthesized according to the severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 (“type”:”entrez-nucleotide”,”attrs”:”text”:”NC_045512.2″,”term_id”:”1798174254″,”term_text”:”NC_045512.2″NC_045512.2) and then amplified from the polymerase chain reaction (PCR) with designed primers (Pu : GCCGGATCCATGTCTGATAATGGACCCCAAAA; Pd : GCCGTCGACAGGCCTGAGTTGAGTCAGCAC). The PCR products were cloned into the pET28a plasmid vector and indicated in BL21 cells (induced by 1mM IPTG, 37C, 250rpm, 5h). Ni-NTA column purification was performed on 50ml Tuberculosis inhibitor 1 bacterial treatment for elute target proteins with different concentrations of imidazole. Then the manifestation of SARS-CoV-2 nucleocapsid was confirmed by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (stained with coomassie amazing blue) ( Kit Number?1A ). Open in a separate window Number?1 Development of our quick SAR-CoV-2 antibody test (ALLtest). (A) Purification of COVD-19 nucleocapsid. M: markers; 1: recombinant SARS-CoV-2 nucleocapsid. (B) Schematic illustration of ALLtest. (C) Standard testing results of ALLtest (from remaining to right: bad, IgG positive, IgM positive, IgG&IgM positive). The entire package includes test cassettes, droppers, package.