Activation of proteins kinase C (PKC) by phorbol 12,13-dibutylate (PDBu, 1
Activation of proteins kinase C (PKC) by phorbol 12,13-dibutylate (PDBu, 1 however, not and isoform in pregnant individual myometrium were higher than those in non-pregnant myometrium. polyclonal anti-PKC(F: ggaactcaggcagaaattcg; R: cagttcttctgtgcccttcc; 196), PKC(F: aaattgccatcggtctgttc; R: ccttcgaattctgattggtca; 628), PKC(F: ttgggagaggttggagagac; R: acgaagtccgggttcacata; 189), CPI-17 (F: gacgtggagaagtggat; R: gcccggctgcttgtg; 220). Real-time RTCPCR evaluation for PKCtarget gene duplicate … [Read more…]